DNA sequence sanitization
GBIF sanitizes the raw DNA/RNA sequences published in occurrence records before they are indexed and made searchable. The goal is to produce a normalised, comparable sequence together with a set of quality metrics, while keeping every transformation transparent and reproducible.
Each occurrence sequence is passed through a fixed, ordered pipeline. Every step is deterministic and configurable, and the original raw sequence is never altered in the source data — only a cleaned copy is derived for indexing. The cleaned sequence is hashed (MD5) to produce a stable nucleotideSequenceID used to group identical sequences across records.
Pipeline stages
The pipeline applies the following stages in order. Each stage takes the output of the previous stage as its input.
| Stage | Description | Example |
|---|---|---|
A |
Normalise whitespace and convert to upper case. All whitespace characters are removed and the sequence is upper-cased. |
|
B |
Detect natural language. The sequence is checked for configured marker words (for example primer or read-merging labels). A match flags the record but does not modify the sequence. |
|
C |
Remove gaps. Characters matching the gap pattern ( |
|
D |
RNA to DNA conversion. Every |
|
E |
Question marks to N. Every |
|
F |
Trim to anchors. Leading and trailing characters are removed until a run of valid nucleotide "anchor" characters is found at each end. |
|
G |
Cap N-runs. Long runs of |
|
Stage A — Normalise whitespace and case
All whitespace (spaces, tabs, line breaks) is stripped from the raw sequence and the result is converted to upper case. If any whitespace was present, this is recorded and contributes to the gapsOrWhitespaceRemoved flag.
Stage B — Detect natural language
Some publishers embed descriptive text or laboratory labels (such as primer names or read-merging status) inside the sequence field. The sequence is tested against a configurable regular expression of marker words. If a marker is found, naturalLanguageDetected is set to true. This stage does not change the sequence, but a detected marker causes the record to be treated as invalid (see Sequence flags and validity).
Stage C — Remove gaps
Alignment gap characters — - and . — are removed. If any gap was present, this contributes to the gapsOrWhitespaceRemoved flag.
Stage D — RNA to DNA conversion
RNA sequences are normalised to DNA by replacing every U (uracil) with T (thymine), so that RNA and DNA representations of the same sequence collapse to a single form.
Stage E — Question marks to N
Question marks, sometimes used to denote an unknown base, are replaced with the IUPAC ambiguity code N.
Stage F — Trim to anchors
Sequences are sometimes padded at the ends with non-nucleotide text, primer remnants, or ambiguous bases. This stage trims both ends back to a recognisable run of nucleotides:
-
Front trim: the sequence is scanned for the first run of at least
anchor_minrunconsecutive anchor characters (anchor_chars). Everything before that run is discarded. If no such run exists anywhere in the sequence, the sequence is considered unusable and is set to an empty string. -
Back trim: the sequence is then scanned for the last anchor run, and everything after it is discarded.
If either end is trimmed (or the sequence is set to an empty string), endsTrimmed is set to true.
Quality metrics
All metrics are calculated on the final cleaned sequence (the output of stage G).
| Field | Type | Description |
|---|---|---|
|
string |
The final cleaned sequence. Set to |
|
integer |
Length of the cleaned sequence in bytes. |
|
float |
Fraction of characters that are not valid IUPAC DNA codes. |
|
float |
Fraction of characters that are ambiguous IUPAC codes (anything other than A, C, G, T or N). |
|
float |
Fraction of characters that are |
|
integer |
Number of N-runs that were shortened in stage G. |
|
float |
GC content, calculated over A/C/G/T bases only. |
|
boolean |
Whether natural-language marker words were found (stage B). |
|
boolean |
Whether either end of the sequence was trimmed (stage F). |
|
boolean |
Whether any whitespace (stage A) or gap characters (stage C) were removed. |
|
string |
MD5 hash of the final cleaned sequence, used for indexing and grouping. |
|
boolean |
Whether the record is considered invalid (see below). |
The fraction metrics are null when the cleaned sequence is empty, and gcContent is null when the sequence contains no A/C/G/T bases.
|
Sequence flags and validity
Sanitization records a set of flags describing what happened during cleaning (for example whether the ends were trimmed or gaps removed) and whether the result is usable. A sequence is flagged invalid when, after cleaning, it still contains characters that are not valid IUPAC DNA codes (nonIupacFraction > 0) or when natural language is detected. Invalid sequences are not indexed: both sequence and nucleotideSequenceID are set to null, while the quality metrics are still reported so the reason can be inspected.
The individual flags and their definitions are documented alongside GBIF’s other occurrence flags — see Sequence issues.
Configuration
The pipeline is driven by a small set of configuration parameters, allowing the thresholds and character sets to be tuned without changing the logic.
anchor_chars: "ACGTU" # Valid anchor characters used when trimming ends
anchor_minrun: 8 # Minimum consecutive anchors required to define an end
gap_regex: "[-\\.]" # Characters removed as gaps
natural_language_regex: "REVERSE|REV|FWD|FORWARD|MERGED|UNMERGED" # Marker words
iupac_rna: "ACGTURYSWKMBDHVN" # Valid IUPAC RNA codes
iupac_dna: "ACGTRYSWKMBDHVN" # Valid IUPAC DNA codes (used for nonIupacFraction)
nrun_cap_from: 6 # Cap N-runs of this length or longer
nrun_cap_to: 5 # ...down to this length
Example
Given the raw input "ACGT-ACGT NNNNNNNNNN ACGT":
-
Stage A removes the whitespace and upper-cases →
"ACGT-ACGTNNNNNNNNNNACGT"(whitespace removed) -
Stage C removes the gap →
"ACGTACGTNNNNNNNNNNACGT"(gaps removed) -
Stages D and E make no change (no
Uor?) -
Stage F finds anchor runs at both ends and leaves the sequence unchanged
-
Stage G caps the run of ten
Ndown to five →"ACGTACGTNNNNNACGT"
The result has sequenceLength 17, gcContent 0.5, nRunsCapped 1, and gapsOrWhitespaceRemoved true.
Example API response
The sanitized sequence and its metrics are delivered through the GBIF occurrence API as a nucleotideSequence array on each occurrence record. The array can also be used as a search filter, for example nucleotideSequence.invalid=false to return only records with at least one valid sequence.
"nucleotideSequence": [
{
"nucleotideSequenceID": "a3ebee35f7fc2883cf68b22c9e9f6ca4",
"targetGene": "COI",
"sequence": "CGTTATATTTTTTATTAGGGAGATGATCTGCGATAATAGGGACGGCTATGAGAGTTTTAATTCGGGTGGAGTTGGGGAGAACGGGAAGATTAATCGGGGATGATCATTTATATAATGTTGTTGTGACTGCTCATGCTTTAGTGATGATTTTTTTTATAGTTATGCCTATCTTAATTGGGGGATTTGGAAATTGGCTGGTTCCTTTAATATTGGGTGCACCGGATATAGCTTTTCCTCGTATGAATAACTTAAGATTTTGGTTATTACCTTTTTCAATAATGTTGTTGTTAATGTCTTCTATAATTGAGACAGGAGTGGGGGCAGGGTGGACTATTTATCCGCCTTTAGCCGGGTTGGAGGGGCATGGAGGAGTAAGTATGGATTTAGCGATTTTTTCATTACACTTGGCTGGGGCTTCATCTATTATGGGGGCTATTAATTTTATTTGTACTATTTTAAACATACGAATAGAGGGAATGACTTTAGATAAGATTCCTTTGTTTGTTTGGTCAGTGCTTATTACTGCAGTCTTATTGTTATTGTCATTACCAGTATTGGCGGGGGCTATTACTATACTTTTGACTGATCGTAATTTTAATACATCTTTTTTTGATCCGGCAGGTGGAGGAGATCCTGTGTTGTTTCAACATTTATT",
"sequenceLength": 655,
"gcContent": 0.37251908396946565,
"nonIupacFraction": 0.0,
"nonACGTNFraction": 0.0,
"nFraction": 0.0,
"nRunsCapped": 0,
"naturalLanguageDetected": false,
"endsTrimmed": false,
"gapsOrWhitespaceRemoved": false,
"invalid": false
}
]
The targetGene field is not produced by the sanitization pipeline. It is the interpreted value of the publisher-supplied target gene, normalised against the GBIF target gene vocabulary (API). All other fields are as described above.
|